Successful application of preimplantation genetic diagnosis for β-thalassaemia and sickle cell anaemia in Italy - PDF

Description
Human Reproduction Vol.17, No.5 pp , 2002 Successful application of preimplantation genetic diagnosis for β-thalassaemia and sickle cell anaemia in Italy S.Chamayou 1,3, C.Alecci 1, C.Ragolia

Please download to get full document.

View again

of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information
Category:

Instruction manuals

Publish on:

Views: 45 | Pages: 8

Extension: PDF | Download: 0

Share
Transcript
Human Reproduction Vol.17, No.5 pp , 2002 Successful application of preimplantation genetic diagnosis for β-thalassaemia and sickle cell anaemia in Italy S.Chamayou 1,3, C.Alecci 1, C.Ragolia 1, A.Giambona 2, S.Siciliano 2, A.Maggio 2, M.Fichera 1 and A.Guglielmino 1 1 Unità di Medicina della Riproduzione, Associazione HERA, Catania, and 2 Servizio di Talassemia, Ospedale V. Cervello, Palermo, Italy 3 To whom correspondence should be addressed at: Unità di Medicina della Riproduzione, Associazione HERA, Piazza Mancini Battaglia 5, Catania, Italy. BACKGROUND: In Italy, the autosomal recessive diseases β-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as social diseases. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for β-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of β-globin gene mutations. METHODS AND RESULTS: The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner s sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the β-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. CONCLUSIONS: These studies represent the first successful application of PGD for β-thalassaemia and sickle cell anaemia in Italy. Key words: allele drop-out/β-thalassaemia/clinical application/preimplantation genetic diagnosis/sickle cell anaemia Introduction Before the clinical application of preimplantation genetic diagnosis (PGD), the only way of preventing the birth of an affected child for couples that risk transmitting an inherited genetic disease, was to undergo prenatal diagnosis (PND), followed by pregnancy termination if the fetus was affected. In 1990, the first cases were reported of PGD by blastomere biopsy on cleavage-stage embryos and sexing by Y-specific DNA amplification for couples that risk having children with X-linked diseases (Handyside et al., 1990). Nowadays, PGD is widely applied using fluorescence insitu hybridization (FISH) for chromosomal disorders, or PCR for single-gene disorders. The ESHRE PGD Consortium Steering Committee reported data on 1318 PGD cycles, 163 pregnancies and 162 babies (ESHRE PGD Consortium Steering Committee, 2000). In the present study, PGD was applied to couples that risked transmitting β-thalassaemia and sickle cell anaemia, and embryos were transferred with wild-type genotype or heterozygous for one wild-type allele. The Sicilian population runs a high risk of transmitting the autosomal recessive diseases β-thalassaemia and sickle cell anaemia. The average gene frequency for these two diseases are 6 and 1% respectively, with ~ carriers. It has been estimated that 1 in 270 couples risks transmitting these β-globin gene disorders, with 66 new births per year (Caronia et al., 1989; Giambona, 1995). Before starting the present programme of PGD for β-thalassaemia and sickle cell anaemia, a survey was carried out to test the willingness of high-risk Sicilian couples to undergo PGD. It was found that 44.4% of couples attending for their first PND, 47.1% of couples attending for their second or further PND without previous experience of therapeutic abortion, and 72.0% of couples undergoing PND with previous experience of therapeutic abortion were willing to undergo PGD for β-thalassaemia and sickle cell anaemia (Chamayou et al., 1998). In addition, an investigation was carried out to determine which cellular lysis protocol provides the greater amplification efficacy and lesser allele drop-out (ADO) on single blastomeres obtained from surplus embryos that are carriers of one β-globin allele mutation. In the present study, nine cycles of clinical PGD application for β-thalassaemia and sickle cell anaemia are reported, in two fertile carrier couples with previous experiences of therapeutic abortion for an affected fetus and five infertile carrier couples European Society of Human Reproduction and Embryology PGD for β-thalassaemia and sickle cell anaemia Table I. Women s ages, reproductive histories and β-globin gene mutations of the couples undergoing preimplantation genetic diagnosis (PGD) Couple Woman s age Reproductive history β-globin gene mutation at time of PGD years Woman Man A 29 Anovulatory infertility Cd39 Cd39 A 30 B 35 Previous spontaneous pregnancies with therapeutic Cd39 Cd39 abortion after prenatal diagnosis of β-thalassaemia-affected fetuses C 29 Previous spontaneous pregnancies with therapeutic IVS1 nt1 HbS abortion after prenatal diagnosis of β-thalassaemia-affected fetuses C 30 D 35 Infertility for oligoasthenoteratozoospermia IVS1 nt6 IVS1 nt110 E 26 Infertility for oligoasthenoteratozoospermia Cd39 Cd39 F 42 Idiopathic infertility IVS1 nt6 IVS1 nt110 G 27 Infertility for oligoasthenoteratozoospermia and anovulation IVS1 nt110 HbS Materials and methods Patient history The women s ages at the time of PGD, the couples previous reproductive histories and the β-globin gene mutations of the seven couples undergoing PGD for β-thalassaemia and sickle cell anaemia are listed in Table I. Couples B and C had a normal reproductive history with earlier pregnancies interrupted after PND of fetuses affected respectively by β-thalassaemia and β-thalassaemia plus sickle cell anaemia. Couples A, D, E, F and G had no previous reproductive history, and contacted the authors reproductive medicine centre for infertility problems. During preconception examinations conducted at the authors centre, both partners of couples A, D, E and G were discovered to be carriers of the β-thalassaemia trait or sickle cell anaemia mutation. Couple A suffered from anovulatory infertility. Couples D and E had an oligoasthenoteratozoospermia infertility; couple G had both anovulatory and oligoasthenoteratozoospermia infertility. Couples D, E and G required ICSI for infertility treatment, and couple F had idiopathic infertility. Both partners of couples A, B and E had the same β-globin mutated allele (Cd39). Both partners of couples C, D, F and G were heterozygous for two different β-globin mutated alleles. Couples A and C underwent two PGD treatments (noted A and C ). The average age of the women patients undergoing PGD for β-thalassaemia and sickle cell anaemia was 31.4 years. ICSI and embryo culture In the IVF programme, controlled ovarian stimulation was carried out for all patients by the administration of GnRH analogue (Suprefact ; Hoechst Marion Roussel Deutschland GmbH, Germany) in a long protocol, followed by recombinant FSH (Gonal-F ; Ares-Serono Ltd, England or Puregon ; Organon N.V. Organon, Holland) from cycle day 3. Ovulation was induced by HCG IU (Profasi ; Ares- Serono). Oocyte retrieval was carried out using vaginal ultrasoundguided aspiration, and the oocytes were cultured in IVF Universal medium (Medicult, Denmark) and incubated at 37 C in5%co 2 in air. The oocytes were micro-injected with the partner s sperm using standard ICSI on the same day (day 0) (Palermo et al., 1992; Van Steirteghem et al., 1993). On day 1, normal fertilization was carefully checked by the observation of pronuclei. The in-vitro culture was prolonged in IVF Universal medium until the 4-cell embryo stage, and continued further in M3 medium (Medicult, Denmark). The biopsy was performed at the 6- to 8-cell embryo stage (morning of day 3). After embryo-biopsy, in-vitro culture was continued in M3 medium until the result of the genetic diagnosis for β-thalassaemia and/or sickle cell anaemia had been obtained. Embryo transfer was carried out on the morning of day 4, using those embryos that continued to show good in-vitro development. Biopsy procedure The method used has been described previously (Hardy et al., 1990; Tarin and Handyside, 1993). The biopsies were performed using an inverted microscope (Olympus IX70, Japan) equipped with Hoffman optics and Narishige manipulators (Japan). Two Narishige MMO- 202D manipulators and two Narishige MM-88 micro-manipulators controlled three pipettes, to each of which was attached microinjectors. The embryo was immobilized using a 120 µm outerdiameter holding micro-pipette in a 5 µl drop of M3 medium buffered with 25 mmol/l HEPES, and under mineral oil. A minimal quantity of Tyrode s acid solution was delivered by drilling a hole in the zona pellucida with a 10 µm inner diameter micro-pipette. A 35 µm inner diameter micro-pipette was introduced through the opening and one blastomere was aspirated out of the zona pellucida. After the biopsy procedure, each embryo was washed three times in M3 medium and incubated in 20 µl of M3 medium. The biopsied blastomere was washed three times in sterile phosphate-buffered saline (PBS) solution and transferred into a 0.2 ml Eppendorf tube containing 2 µl of sterile PBS solution. Its presence was carefully checked in the Eppendorf tube under a Nikon SMZ-2T stereo-microscope (Japan). Each blastomere sample was immediately conserved at 20 C until the biopsy procedure had been completed for all available embryos. If the cytoplasmic membrane of the first biopsied blastomere was opened during the biopsy procedure, a second blastomere was removed and conserved. This second blastomere was sampled into the same Eppendorf tube as the preceding one. If the embryo had seven or more cells, a second blastomere was biopsied and transferred into a second Eppendorf tube with a view to comparing the genetic diagnosis of two cells from the same embryo. Cell lysis Having previously determined that a minor ADO rate was obtained after a cell was lysed by alkaline lysis compared with cell lysis by proteinase K/sodium dodecyl sulphate or freeze thawing in liquid nitrogen (unpublished data), the alkaline lysis method was subsequently used on single blastomeres and before β-globin gene amplification. A 5 µl aliquot of lysis buffer (200 mmol/l KOH, 50 mmol/l dithiothreitol, ph 9.5) was added to each sample. The samples were heated for 10 min at 65 C. Subsequently, the alkaline 1159 S.Chamayou et al. Table II. Sequences of outer and inner oligonucleotide PCR primer pairs Outer primers Inner primers Oligonucleotide sequences Sense: GTACGGCTGTCATCACTTAGACCTCA Sense: ACATTTGCTTCTGACACAACTGTG Amplification product size Antisense: TCATTCGTCTGTTTCCCATTCTAAAC Antisense: GCCATCACTAAAGGCACC 743 bp 405 bp lysis buffer was neutralized by the addition of a neutralizing buffer (900 mmol/l Tris HCl, ph 8.3, 300 mmol/l KCl, 200 mmol/l HCl) (Cui et al., 1989). After cell lysis, the β-globin gene of all samples containing biopsied blastomeres was amplified by nested PCR. Nested PCR The first and second PCR mix contained PCR buffer (2.0 mmol/l MgCl 2, 10 mmol/l Tris HCl, ph 8.6, 50 mmol/l KCl, 0.01 w/v gelatin), 200 µmol dntp (Boehringer Mannheim, Germany), 100 pmol primers (HPLC purification grade, Pharmacia, Sweden) and 0.5 U Taq polymerase (Perkin Elmer, USA). PCR mix 1 contained the outer primers, and PCR mix 2 contained the inner primers (Table II). The outer and inner primers were used in everyday routine of PND application (Maggio et al., 1993). PCR mix 1 was added to each Eppendorf tube containing a single blastomere in order to obtain a 100 µl total reaction volume. Each sample was put into a DNA thermal cycler (GeneAmp PCR System 2400, Perkin Elmer, USA). The programme of the PCR reaction 1 was 5 min at the initial 94 C denaturation temperature, followed by 30 cycles of 60 s at 94 C (denaturation), 60 s at 55 C (annealing), 60 s at 72 C (extension) and a final extension step at 72 C for 10 min. A 5 µl aliquot of the first PCR was added to 95 µl of PCR mix 2 and was run on the PCR programme 2: 5 min at 94 C followed by 40 cycles of 60 s of denaturation at 94 C, 60 s of annealing at 55 C, 60 s of extension at 72 C and a final extension step at 72 C for 10 min. A portion (15%) of the second PCR product was run on a 2% agarose gel in 0.5X Tris-borate/EDTA buffer stained with 0.5 µg/ml ethidium bromide. The position of PCR primers on the β-globin gene for genotype analysis of β-thalassaemia and sickle cell anaemia is shown in Figure 1. Precautions against contamination Routine precautions were taken in order to avoid contamination. All PCR reactions were prepared under a laminar flow hood, gloves were changed very frequently, and tips with filters were used. The DNA thermal cycler was in a separate room. After cell isolation, noncontamination control samples were prepared on buffered M3 medium where the embryos were immersed during the biopsy for each biopsied embryo and on sterile PBS solution where biopsied blastomere(s) were immersed for each biopsied blastomere. One negative control was prepared on PCR mix 1 added by alkaline lysis reagents. One positive amplification test was prepared on 10 pg of purified DNA. All negative and positive controls were amplified by nested PCR. Genetic diagnosis The β-globin gene mutations diagnosed were: Cd39 (C T), IVS1 nt1 (G A), IVS1 nt6 (T C) and IVS1 nt110 (G A) and HbS (sickle cell mutation). The genetic diagnosis of amplified samples was performed by enzymatic digestions for the corresponding mutations and reverse dot blot, except for IVS1 nt110 mutation where only reverse dot blot analysis was available Enzymatic digestions HbS and IVS1 nt6 mutations Samples (17.5 µl) of the PCR reaction product were digested by the addition of 5 U restriction enzyme DdeI (Boehringer Mannheim) for the HbS mutation or SfaNI (Biolabs, USA) for the IVS1 nt6 mutation and 2 µl of buffer 10X. The reaction tube was incubated for 3 h at 37 C. IVS1 nt1 mutation Samples (17.5 µl) of the PCR reaction product were digested by the addition of 5 U restriction enzyme BsaBI (Biolabs) and 2 µl of buffer 10X. The reaction tube was incubated for 3hat60 C. Cd39 mutation Samples (14 µl) of the PCR reaction product were digested by the addition of 3 U restriction enzyme MaeI (Boehringer Mannheim) and 16.5 µl of buffer 2X. The reaction tube was incubated for3hat45 C. It had been verified previously that the enzymatic digestions were complete when the incubation period was 3 h. The enzymatic digestion product was run on 3% ultrapure agarose gel (Gibco BRL, UK) and stained with 0.5 µg/ml ethidium bromide. The wild-type allele is noted HbA. Figure 2 shows the corresponding restriction enzyme patterns on normal and mutated alleles for each mutations. Reverse dot blot Reverse dot blot was used to diagnose the IVS1 nt110 mutation of the β-globin gene and to verify the genetic diagnosis of the HbS, IVS1 nt6, IVS1 nt1 and Cd39 mutations according to the enzymatic digestions. To perform the reverse dot blot, a second PCR reaction mix was prepared which contained 200 µmoles dntp and biotin-16-dutp. The hybridization to amino-modified oligonucleotides for β-thalassaemia and sickle cell anaemia and colour detection have been described elsewhere (Maggio et al., 1993). Non-transferred and surplus embryos The embryos that were biopsied and diagnosed but not transferred (defined non-transferred embryos ) and the surplus embryos that were not available for biopsy (slow embryo development or highly fragmented; defined as surplus embryos ) were donated to research programmes with the written consent of the couple. The nontransferred embryos were transferred into a 0.2 ml Eppendorf tube containing 2 µl of sterile PBS solution and their genetic diagnosis was compared with the previous blastomere analysis. When possible, one or two blastomeres were biopsied from the surplus embryos. As previously described, the blastomere and remaining embryo genotypes were determined and compared among them. Definitions Amplification efficiency is the number of samples with amplification of one or both alleles on all amplification samples. Amplification failure is the non-amplification of both alleles of a single cell. ADO PGD for β-thalassaemia and sickle cell anaemia Figure 1. Position of PCR outer and inner primers on β-globin gene for genotype of β-thalassaemia and sickle cell anaemia. Figure 2. Scheme of restriction map on wild-type allele and mutated allele after nested PCR. is the absence of amplification of one of the two alleles of a single cell and is calculated on the number of amplified samples. Results In-vitro results Between April and November 2000, nine cycles of PGD for β-thalassaemia and sickle cell anaemia were performed for seven high-risk couples. A total of 147 oocytes was retrieved, of which 131 were micro-injected with partner s sperm. Consequently, 72 zygotes were obtained and 69 embryos were observed on day 2. Of these embryos, 33 developed well on day 3 and were biopsied; 32 embryos were successfully biopsied and 40 blastomeres were obtained. Twenty-five embryos survived biopsy and were still developing on day 4. Nineteen of the surviving biopsied embryos were genetically diagnosed as being available for transfer, and 17 of these were transferred into the mother s uterus. All couples obtained an embryo transfer. The in-vitro results are shown in Table III. PGD for β-thalassaemia and sickle cell anaemia of embryos available for biopsy Of 36 samples containing one or two blastomeres from 32 biopsied embryos, 35 were successfully amplified after alkaline lysis and nested PCR (amplification rate 97.2%). The 40 biopsied blastomeres were lysed and the samples amplified by nested PCR and genetically analysed. Seventeen embryos were diagnosed homozygous for wild-type allele, seven embryos were heterozygous for one wild-type allele and one mutated allele, two embryos were homozygous for mutated alleles, and five embryos were heterozygous for both mutated alleles. For four embryos, two blastomeres were biopsied and analysed separately; in each case, the genotypes were identical for the two blastomeres. There was no amplification in one sample of couple E containing one blastomere. In the diagnosis of embryos from couples with different mutated alleles, no aberrant diagnosis was obtained (homozygous for one mutated allele). The restriction enzyme analysis of parental mutations and biopsied single blastomeres in the first PGD attempt of the couple A, and in the second attempt of the couple C (denoted C ) is shown in Figure 3. The PGD of biopsied embryos and genotype confirmation of transferred embryos by chorionic villus sampling (CVS) during pregnancy or by the analysis of miscarriage material is summarized in Table IV. Genetic diagnosis for β-thalassaemia and sickle cell anaemia of biopsied blastomeres from non-transferred and surplus embryos Fourteen embryos were biopsied on day 3 but not transferred because they were diagnosed as carriers of two mutated alleles or because they did not continue their in-vitro development on day 4. The whole embryos that were not transferred were analysed, and this diagnosis was compared with the previous single biopsied blastomere result. In only one case (couple B) did the diagnosis of a biopsied blastomere on day 3 differ from that of the non-transferred embryo; the former resulted in Cd39/Cd39, while the latter resulted in HbA/Cd39. In the case of the other 13 non-transferred embryos, the diagnoses of single biopsied blastomeres were confirmed by wholeembryo diagnosis. One blastomere and the whole embryo of the surplus 1161 S.Chamayou et al. Figure 3. Restriction enzyme analysis of parental mutations and biopsied blastomere
Related Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks