primer dna.docx

1 catcctgacc ctcaagtacc ccatcgaaca cggcattgtc accaactggg acgacatgga 61 gaagatctgg caccacacct tctacaacga gctgcgcgtg gcccccgagg agcacccggt 121 gctgctcacc gaggccccct tgaaccccaa ggccaaccgt gagaagatga ctcagatcat 181 gttcgagacc ttcaacaccc cagccatgta cgtggccatc caggccgtgc tgtctctgta 241 cgcttctggc cgcaccactg gtattgtcat ggactctggg gacggggtca cccacactgt 301 gcccatctac gaggggtacg ccctgcccca cgccatcctg cgtctggacc tggctggccg 361 ggacctgacg gactacctca tgaagatcct cacgg

Please download to get full document.

View again

of 3
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.


Publish on:

Views: 8 | Pages: 3

Extension: DOCX | Download: 0

   1 catcctgacc ctcaagtacc ccatcgaaca cggcattgtc accaactggg acgacatgga 61 gaagatctgg caccacacct tctacaacga gctgcgcgtg gcccccgagg agcacccggt 121 gctgctcacc gaggccccct tgaaccccaa ggccaaccgt gagaagatga ctcagatcat 181 gttcgagacc ttcaacaccc cagccatgta cgtggccatc caggccgtgc tgtctctgta 241 cgcttctggc cgcaccactg gtattgtcat ggactctggg gacggggtca cccacactgt 301 gcccatctac gaggggtacg ccctgcccca cgccatcctg cgtctggacc tggctggccg 361 ggacctgacg gactacctca tgaagatcct cacggagcgc ggctacagtt tcaccaccac 421 cgccgagcgg gaaattgtgc gtgacatcaa ggagaagctg tgctacgtgg ccctggattt 481 tgagcaggag atggccacgg ccgcgtcctc gtcctccctg gagaagagct acgagctgcc 541 cgacgggcag gtgatcacca tcggcaacga gcggttccgc tgccccgagg cgctcttcca 601 gccttccttc ctgggtatgg agtcctgtgg catccacgag accaccttca actccatcat 661 gaagtgtgac gttgacatcc ggaaggacct ctacgctaac acggtgctgt ctggcgggac 721 caccatgtac cccggcatcg ccgacaggat gcagaaggag atcacagctc tggcgcccag 781 cacgatgaag atcaagatca tcgctccccc tgagcgcaag tactccgtgt ggatcggggg 841 ctccatcctg gcgtcgct Forward primer : 5’ -gcccatctacgaggggta- 3’ = 18 gc = 11 ta= 7 3’ -atggggagcatctacccg- 5’= diner 4 Nb: berpasangan jika dibalik 1-3 yang berpasangan terjadinya hair pin rendah jika diatas 5 terjadi hair pin akan semakin banyak Hair-pin terjadi jika jarak nya jauh Bagaimana modifikasi gen? Jika di cloning harus dimasukan ke plasmid Gen ditambahi clong site : Spe 1 5 ’ -ACTAGT-3 ’    Ditambahi spe 1 5’ -gcccatctacgaggggta- 3’ Forward star codon ditambahi spe 1 Langsung dikopi sekuen asli dan di tambahi sebelum stard codon 5’ -ACTAGTgcccatctacgaggggta- 3’ actagtgcccatctacgaggggta spe 1 E CO R1 actagtgcccatctacgaggggta SPE 1g PROMOTOR (GFR)*ECO R1 Membuat reverse primer: Cloning- site SPE 1 DAN NOT 1 5’ -ACTAGT- 3’ = spe 1 Forward primer : Spe 1 – b-actin Reverse primer : b- actin-GFP-NOT 1 5’ -gcccatctacgaggggta- 3’   3’ -cgggtagatgctccccat- 5’  anti sense 5’ -tacccctcgtagatgggc- 3’  Reverse primer :b – actin-GFP-NOT 1 GFP diletakan sesudah stard codon agar bisa terekspresi NOT 1 5’ -GCGGCCGCtacGFPGFPGFPccctcgtagatgggc- 3’  Pemotongan sebelum stop codon dan ketentuan panjang 18-22 basa nitrogenn 5’ -GCGGCCGCtacGFPGFPGFPcc- 3’   Forward : langsung dikopi dan ditambah cloning site Reverse : dirubah dulu dan dikopi ditambah cloning site   
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks