Nuove molecole e peptidi quali farmaci regolatori del ciclo cellulare e della risposta a chemioterapici nei tumori epiteliali e cutanei

Description
PROGRAMMA 3 Trasferimento delle conoscenze allo sviluppo di interventi volti a prevenire, diagnosticare e trattare il cancro. Nuove molecole e peptidi quali farmaci regolatori del ciclo cellulare e della

Please download to get full document.

View again

of 30
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information
Category:

Government & Nonprofit

Publish on:

Views: 4 | Pages: 30

Extension: PDF | Download: 0

Share
Transcript
PROGRAMMA 3 Trasferimento delle conoscenze allo sviluppo di interventi volti a prevenire, diagnosticare e trattare il cancro. Nuove molecole e peptidi quali farmaci regolatori del ciclo cellulare e della risposta a chemioterapici nei tumori epiteliali e cutanei Coordinatore del Progetto: Prof. Gerry Melino UO 1: Prof. Gerry Melino (IDI-IRCCS) E.Candi (Universita Tor Vergata) UO 2: Dott. Giovanni Blandino (Ist. Naz. Tumori Regina Elena) Prof.ssa MG Santoro (Universita di Tor Vergata) Dott.ssa L Lanfrancone (Istituto Europeo di Oncologia) UO 3: Dott.ssa Stefania D Atri (IDI-IRCCS) Dott.ssa E Alvino (CNR, Ist. Neurobiologia e Med. Molec.) Dott. U Pfeffer (Ist. Naz. Per la Ricerca sul Cancro) Prof. Golino (Universita della Sapienza) OBIETTIVO PRINCIPALE del PROGETTO: Identificare nuove molecole e peptidi quali farmaci regolatori del ciclo cellulare e della risposta a chemioterapici nei tumori epiteliali e cutanei OBIETTIVI SPECIFICI: Sviluppare nuove molecole inibitori della E3 ubiquitin ligasi ITCH e di validare tali molecole nella via di p63/p73 e di Hedgehog/Gli; Studio del potenziale terapeutico di pepidi capaci di disassemblare complessi proteici (mp53/p73) ad attivita oncogenica; Studio del potenziale terapeutico di inibitori selettivi di NF-kB/IKK e delle cicline-chinasi dipendenti (CDK), come singoli agenti ed in associazione agli inibitori di ITCH e ai chemoterapici; Studio dell espressione della proteina chinasica RaLP nei melanomi e caratterizzazione del pathway di trasduzione del segnale. a c The p53 family b 8% 91% 83% Cancer minimal Epidermal lethal Neural severe McKeon F & Melino G Fog of war: the emerging p53 family. Cell Cycle. (27) 6, 3: Melino G, De Laurenzi V, Vousden KH p73: friend or foe in tumorigenesis. Nature Review Cancer. (22) 2: Melino G, Lu X, Crook T, Knight RA Functional studies of p73 and p63: Development and Cancer TIBS. (23) 28: 663 DNA damage Replicative Stress ALTERATIONS DNA-PK PARP Ku7/Ku86 Sensors chk2 ATM c-abl ATR chk1 HR NHEJ Signals mdm2 p63 p53 p73 BRCA1 NSB1 rad5 MRE11 cdc25 NER MMR BER Effectors cdc25 bax CD Noxa. Apoptosis p21 gadd45. G1 S G2 Cell Cyle Arrest Cdc2. DNA Repair EFFECTS Gong et al Nature : 86 Melino et al. JBC : 876 Bernassola et al JEM : 1545 Gressner et al Embo J : 2458 Mueller et al CDD : 1564 Flinterman et al. JBC : 5945 Vigano et al Embo J : 515 Rossi et al PNAS : Sayan et al. JBC : 13566 ONCOGENES DNA methyltransferase inhibitors ARF Ub E3 ligase inhib. nutlin mdm2 activators PRIMA-1 p53 DNA damage Cell Cycle Arrest Senescence Apoptosis ITCH E3 ligase regulates p63 stability N TA PR DNA Binding Domain OD PR SAM N C2 Ca2+ dependent lipids interaction WW WW protein-protein interacting domain Phage Display HECTc C catalytic domain transfering ubiquitin to substrate C TAp63 Itch Ubiquitin E3 ligase (NEDD4 family) 18H Mice natural Knockout (immune defects) Interacts with Atrophin Degrades (transcription factor): Jun-B, c-jun, Notch, FLIP Binding Ubiquitylation Degradation pcdna ITCH wt ITCH mut p63 p53 p63 bound pcdna ITCH wt ITCH mut p63 p53 Ubiquitylated p63 Cyclohexamide (h) p63 pcdna Degraded p63 tubulin p63 tubulin IP: Itch WB: p63/p53 IP: p63/p53 WB: HA(Ub) ITCH Open question Can we control p63/p73 protein levels? Ar Rigel Itch inhibitors search by HTP R X Ar N S O O X= O, S Ar HighTroughPut screening 48 Hits cut off 5% 287 Hits cut off 7% Stability/Itch binding studies PNAS, , 34: N4BP1 p63 p73 ITCH Ub, degradation YAP, Wwox JNK QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. PNAS, , 27: THERAPY Conclusion 1 - p63 is involved in DNA repair/cancer - p63 regulates chemosensitivity in cancer - p63 is transcriptionally regulated by PML - p63 is Ub & degraded by Itch - Itch is regulated by N4BP1 - low MW Itch inhibitors are under development Proteasome= 1 E1= 1 E2= 1 perspective ITCH is a candidate therapeutical target (to regulate p63/p73) E3= 1 human Non-Apoptotic Function p63 function? p63-/- p63-/-;δn wt +/+ -/- TIFF (Uncompressed) d are needed to see th ecompressor is picture p63 function? Failure of differentiation Failure of stem cells D Roop F McKeon Cornified Envelope Granular Spinous Basal Membr TAp63 ΔNp63 TAp63 ΔNp63 stem cell Ets-1 PERP, Gata3 K14 IKKa integrins TA cell CE keratinocytes p63 mutations in human syndromes N TA PR DBD OD TA2 SAM TI C K193E K194E R24W R24Q R227Q C269Y S272N R298Q R279C R28C R279H R28H R279Q R28S D312H P39S C38S C36R R34W R34Q L518F L518V C526W C526G Q634X I541T Q54L T537P G534V EEC, (SHFM) AEC SHFM EEC ADULT AEC SHFM LMS Ectrodactyly, Ectodermal dysplasia and Cleft lip/palate syndrome Acro-Dermato-Ungual-Larimal-Tooth syndrome Ankyloblepharon-Ectodermal dysplasia-clefting (or Hay-Wells Syndrome) Split Hand-split Foot Malformations Limb-Mammary Syndrome p63 regulation: mir mir are essential for epithelial development K14:Dicer1 Knockout - Few Hair follicle (invaginated) - Abnormal Epithelial Layers (thin, granules) mir expressed in skin mirs expressed in epidermis and hair follicle nd mir-2c Ovarian cancer, leukemia ZEB1, ZEB2 [4;45] nd mir-23 Skin, hair, ovary, Squamous Cel Carcinoma mouse mirs detected with high signal intensity in microarray of control mouse skin (Andl et al, CB 26 and in Yi et al, Nature Genetics 26) p63 [22;23] Zfp281[22] SOCS-3 [46] nd mir-25 Ovarian cancer, Squamous Cel l Carcinoma mir-26 nd Skeletal muscle Pol-a, Cx43, ERa, Ftl1 [47] mir-214 nd Ovarian cancer PTEN [48] mir-351 nd? nd mir-429 EMT ZEB1, ZEB2 [4;45] Let-7a Let-7a Lymphome Myc [49] Let-7b Let-7b Acute lymphoblastic leukemia Let-7c Let-7c? Let-7d nd? Let-7f Let-7f Angiogenesis, antigen induced Tcell differentiation Let-7g Let-7g? Let-7i Let-7i Immune responce TLRs [5] Table 1. mirs expressed in epidermis and hair follicle mirs mirs expressed in expressed in hair follicle epidermis Expression and/or biological function mir-15a nd Leukemia mir-15b mir-15b Leukemia, antigen incuced T cell differentiation Target [ref] Bcl-2 [26] mir-16 mir-16 Leukemia, antigen incuced T cell differentiation mir-17-5p mir-17-5p T cells, monocytes differentiation AML-1 [27] mir-18 mir-18? nd mir-19b T cells, leukemia Mylip, Rbp1like [28] mir-2 mir-2 Megakaryiocytopoiesis mir-21 mir-21 Invasion, metastasis, Squamous Cell Carcinoma, antigen incuced T cell differentiation TPM1, PDCD4, maspin [29] mir-24 mir-24 Myogenic differentiation nd mir-27a Breast cancer Myt-1, ZBTB1 [3] mir-27b mir-27b Angiogenesis CYP1B1 [31] nd mir-3b? nd mir-34a Cancer apoptosis Bcl-2 [32] mir-92 mir-92 Lymphoma, B cell development PTEN, Bim [33] nd mir-93 Gastric cancer p21,e2f1, Bim [34] mir-99b mir-99b Megakaryiocytopoiesis mir-16b mir-16b Gastric cancer p21,e2f1, Bim [34] nd mir-125a Breast cancer ERBB2, ERBB3 [35] mir-125b mir-125b Breast cancer, ovarian cancer ERBB2, ERBB3 [35] mir-126 nd Endotelial cells/leukocytes adherence, breast cancer VCAM1, SOX4, V-CRK [36;37] mir-127 mir-127 Tumor suppression BCL6 [38] mir-13a mir-13a Angiogenesis, Megakaryiocytopoiesis GAX, HOXA5 [39] nd mir-133b Colorectal cancer nd mir-141 Placenta, EMT ZEB1, ZEB2 [4] mir-143 nd Adipocytes differentiation, B-cell cancer mir-152 nd Breast cancer nd mir-191 Leukemia mir-196 nd Limb development, myeloid differentiation ERK5 [41;42] HOXB8 [43] mir-199a nd Leukemia, ovarian cancer mir-199b nd? nd mir-2a Ovarian cancer, EMT ZEB1, ZEB2 [4] nd mir-2b Ovarian cancer, brain, EMT Zfhx1b [44] human mirs showing more than 1.7 fold change between normal skin and psoriasis and normal skin and atopic eczema (Sonkoy et al PLoS ONE 26) mir expressed in skin mirs expression in psoriasis and atopic eczema Psoriasis Atopic eczema mirs mirs mirs mirs up regulated down regulated up regulated down regulated mir-17-5p mir-1a mir-17-5p mir-122a mir-2a mir-22 mir-2a mir-133a mir-21 mir-3c mir-21 mir-133b mir-3e-5p mir-99b mir-24 mir-215 mir-31 mir-1 mir-27a mir-326 mir-16a mir-122a mir-29a mir-335 mir-142-3p mir-125b mir-16b mir-483 mir-146b mir-133a mir-146a mir-515-5p mir-146a mir-133b mir-193a mir-519 mir-2a mir-197 mir-199a mir-141 mir-215 mir-146 mir-23 mir-326 mir-365 mir-381 mir-518b mir-524 let-7e mir-23 inversely correlates to p63 nt a 22 - days diff. mir-23 b nt days diff. mir U2snRNA U2snRNA Mw (KDa) lanes days diff. p63 Mw (KDa) lanes days diff. p involucrin 56 - K actin lanes 24 mir p days diff. Arbitrary units Arbitrary units actin lanes 12 mir p days diff. mouse human Arbitrary units a mir-23 targets p63 1K 2K Human TP73L NM_ UTR length:2772 bp mir-23 c b Luc activity (%) bp Hs AUGUUAAAGAGAAUGAGUCCUUGAUUUCAAAGU-UUUGUUGUACUUAAAU Mm AUGCAAAAGCAAAUGAGUCCUUAAUUUCAACAU-UUUGUUGUGUUUAAAU Rn AUACUAAAGAGAAUGAGUCCUUAAUUUCAACAU-UCUGUUGCAUUUAAAU Cf AUGUUAAAGAGAGUAAGUCCUUGAUUUCAAAGU-UUUAUUGUGCUUAAAU Gg ACUUCAAAGAGCA-GCGUCCUUGAUUUCAAAGUAUUUAACGUGCUCA GAUCACCAGGAUUUGUAAAGUG -5 hsa-mir AUGUUAAAGAGAAUGAGUCCUUG--AUUUCAAAGUUUUGUUGUAC -3 p63-3 UTR 5 - AUGUUAAAGAGAAUGAGUCCUUG AGUUUUGUUGUAC -3 p63-3 UTRdel 23 p63-3 UTR p63-3 UTRdel 23 Ctr hsa-23 mmu-23 Ctr hsa-23 mmu-23 d Relative Expression Level (%) Ad-Scr Ad-23 CaCl 2 h 24h 48h e Mw KDa Ad-Scr Ad-miR hrs hrs Ad-Scr Ad-miR-23 p63 actin lanes Arbitrary units Arbitrary units mir-23 seems insufficient to promote differentiation a Mw (KDa) scramble mir-23 scramble + CaCl days p63 involucrin 48 - actin lanes p days scramble mir-23 scramble + CaCl 2 4 involucrin days scramble mir-23 scramble + CaCl 2 b Relative Expression Level (%) h 24h 48h Involucrin mock Ad-Scr Ad-23 CaCl h 24h 48h TG5 mock Ad-Scr Ad-23 CaCl h 24h 48h TG1 mock Ad-Scr Ad-23 CaCl 2 mir-23: clonogenicity cont mir-23 antagomir-23 (1.7% +/-.1) (.7% +/-.18) (2.9% +/-.16) p .19 p .18 mir-23: ES differentiation a neural i. ES GFPA BMP4 ii. ES neural Serum epidermal epithelial K8/K18 K5/K14 b neural BMP4 serum ES epidermal epithelial c d Fold change (AU) 1 Fold change (AU) BMP-4 Serum K14 K days of differentiation ΔNp63 mir days of differentiation mir-23 CYCLE ARREST QUIES- CENT p63 SOCS-3 Zfp281 PROLIFE- RATIVE ADHESION LIPIDS METABOLISM TG & SUBSTRATES PROTEASES S T E M N E S S D I F F E R E N T I A T I O N Effects of UVC irradiation on mir-23 and ΔNp63α a Mw (KDa) hrs 8 - ΔNp63 Arbitrary units actin lanes b Arbitrary units mir hrs c Cell number (%) hrs 12 hrs 24 hrs 36 hrs G1 G2 S d % SubG1 events hrs e Mw (KDa) hrs PARP c-jun actin lanes JHU-12 cells (SCC) (.5 J/cm2) for 3 sec - The mir-23 / ΔNp63α pathway is retained in Squamus Cell Carcinoma - mir-23 is induced by UV stress mir-23 alone is sufficient to down regulate ΔNp63α and trigger death a Mw (KDa) mock Ad-scr Ad-h p63 actin Arbitrary units b % SubG1 events mock Ad-scr Ad-h23 c Cell number (%) mock Ad.scr Ad-h23 G1 G2 S JHU-12 cells (SCC) Project 3: MELINO CONCLUSION Definition of the role of the p53 (p63/p73) family Studies of p63 & Stem Cells Analysis of mir in epidermal morphogenesis Development of Ub E3 (Itch) inhibitors Validation of Ub E3 (HECT) inhibitors for Cancer Incidence of p73 alterations in cancer.41% 21.76% p73 as prognostic factor? Hepathoma patients p73 in hepatoma cells ΔNp73 is a negative Prognostic Factor N TA PR DBD OD PR SAMTI C N PR DBD OD PR SAMTI C TAp73 ISOFORM ΔNp73 ISOFORM ΔNp73 is induces by TAp73 and p53 ΔNp73 inhibits TAp73 and p53 apoptosis hypothesis ΔNp73 acts as an oncogene TAp73 induces apoptosis hypothesis TAp73 acts as a tumour suppressor The ratio TAp73/ΔNp73 dictates the response to chemotherapy
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks