non più di 5 persone ogni milioni di persone soffrono di una malattia rara abitanti. 8000: 80% origine genetica - PDF

Description
LE MALATTIE RARE MALATTIE RARE Malattia che colpisce non più di 5 persone ogni abitanti. Le Malattie Rare conosciute e diagnosticate sono circa 8000: 80% origine genetica 75% insorgenza in età pediatrica

Please download to get full document.

View again

of 60
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information
Category:

Legal forms

Publish on:

Views: 15 | Pages: 60

Extension: PDF | Download: 0

Share
Transcript
LE MALATTIE RARE MALATTIE RARE Malattia che colpisce non più di 5 persone ogni abitanti. Le Malattie Rare conosciute e diagnosticate sono circa 8000: 80% origine genetica 75% insorgenza in età pediatrica Nei 25 paesi dell Unione Europea 30 milioni di persone soffrono di una malattia rara Italia: 61 milioni di persone (dati ISTAT al 1 gennaio 2013) Il 6-8% della popolazione italiana è affetto da malattie rare 5 milioni Lombardia: 10 milioni di residenti Provincia di Brescia : 1.2 milioni di residenti legislazione DECRETO MINISTERIALE N 279 DEL 18 MAGGIO 2001 Istituzione della Rete nazionale per la prevenzione, sorveglianza, diagnosi e terapia delle Malattie Rare Individuazione di un gruppo di malattie rare che godono dell esenzione dalla partecipazione al costo delle prestazioni sanitarie correlate in fase diagnostica e terapeutica Creazione del Registro Nazionale delle Malattie Rare Creazione di presidi : medici esperti in singole malattie rare, formulano diagnosi, forniscono esenzione e piano terapeutico Certificazione: la rete Certificazione di malattia rara 2006: zero 2007: : : : : : 826 TOTALE: 2389 S. Di Ehlers-Danlos: 94 M. Arnold-Chiari: 30 Definition DIAGNOSTIC GENETIC TESTS Process involving the individual and The extending analysis of human to him/her family DNA, RNA, chromosomes in order to detect heritable disease-related genotypes/ mutations for clinical purposes (US Task force on genetic testing 1999) -MANDATORY FOR ADDRESSING ALL DISEASE CARE LANDSCAPES Confirmation of the clinical diagnosis Information about preventive measures Feasibility of prenatal testing Enrollment in novel trials Having appropriate, suitable therapies Facing and following ethical issues GENETIC TESTS: types Chromosomal testing (karyotype) Molecular testing (including a variety of tests to identify mutations at the DNA/RNA level) PrenataL Intellectual disability (FRAXA) GENETIC TESTING Perinatal (screening) PKU, Hypothyroidism Postnatal Diagnostic Cystic Fibrosis, Duchenne muscular dystrophy, Thalassemia Presymptomatic Huntington, Spinocerebellar Ataxias Predictive (susceptibiity genes) Diabetes, Alzheimer, Breast Cancer Preconceptional (couple) GENETIC TESTS ANALYTICAL VALIDITY SENSITIVITY ACCURACY REPEATABILITY GENETIC TESTS CLINICAL VALIDITY SPECIFICITY OF THE TEST IN THE RARE DISEASE FOR DIAGNOSTICS THE ABOVE PARAMETERS SHOULD BE 95% Genetic tests interpretation the bioinformatics The clinical competence MEDICAL GENETICISTS Array gcgcctgccatgggggagggtgccaggggagaggcactgggggtgtctgagcgaccccca cccctgttgcaggacttcagggccacaggtgctgccaagatgctccagggcacctgctcc GTGCTCCTGCTCTGGGGAATCCTGGGGGCCATCCAGGCCCAGCAGCAGGAGGTCATCTCG CCGGACACTACCGAGAGAAACAACAACTGCCCAGgtgccaggggtcgggggccgggggct ctgggcatttggggggcagttgggaccagtacccaggtgccaggggtcgggggccggggg ctctgggcatttggggggcagttgggaccagtacccaggtgccaggggtcgggggccggg ggctctgggcatttggggggcagttgggaccagtacccaggtgccaggggtcgggggccg ggggctctgggcatttggggggcagttgggaccagtacccaggtgccaggggttgggggc cgggggctctggcattcgggggcagtgaggtcaaacccacaaacaggcacggggccagga aacggggctccaacagcagtccctcctgaggctggctcgtgacaggtcctgtgccccaca AGAAGACCGACTGCCCCATCCACGTGTACTTCGTGCTGGACACCTCGGAGAGCGTCACCA TGCAGTCCCCCACGGACATCCTGCTCTTCCACATGAAGCAGTTCGTGCCGCAGTTCATCA GCCAGCTGCAGAACGAGTTCTACCTGGACCAGGTGGCGCTGAGCTGGCGCTACGGCGGCC TGCACTTCTCTGACCAGGTGGAGGTGTTCAGCCCACCGGGCAGCGACCGGGCCTCCTTCA TCAAGAACCTGCAGGGCATCAGCTCCTTCCGCCGCGGCACCTTCACCGACTGCGCGCTGG CCAACATGACGGAGCAGATCCGGCAGGACCGCAGCAAGGGCACCGTCCACTTCGCCGTGG TCATCACCGACGGCCACGTCACCGGCAGCCCCTGCGGGGGCATCAAGCTGCAGGCCGAGC GGGCCCGCGAGGAGGGCATCCGGCTCTTCGCCGTGGCCCCCAACCAGAACCTGAAGGAGC AGGGCCTGCGGGACATCGCCAGCACGCCGCACGAGCTCTACCGCAACGACTACGCCACCA TGCTGCCCGACTCCACCGAGATCGACCAGGACACCATCAACCGCATCATCAAGGTCATGg ccgtccacccactccgggcctcactttacccctctgtgagtgcggaggcc Gene card for (congenital muscular dystrophy Ullrich type) The genes library, how to read the DNA book Collection of the family history and pedigree (mode of inheritance) AUTOSOMAL DOMINANT X-LINKED MATRILINEAR AUTOSOMAL RECESSIVE POLYGENIC OBJECTIVES OF GENETIC COUNSELLING To discriminate between environmental and genetic factors in the presenting phenotype To address a better phenotype definition To identify the possible mode of inheritance of the condition To identify the causative genotype To identify the at risk individuals To provide information regarding the quality and quantity of risk To provide support in the autonomous decision process in prevention and therapeutic strategies, taking into account the ethical issues The prenatal diagnosis INVASIVE NON INVASIVE Donne in Gravidanza e Tutela della Maternità Decreto Legge G.U. n 245 del Allegato C Risk for Mendelian diseases RARE DISEASES (maternal age independent) Family recurrence of a specific mendelian disease (Thalassemia, cystic fibrosis, Duchenne muscular dystrophy etc.) Prenatal diagnosis APPROPRIATE (under Italian LEA and covered by SSN) Non Invasive Prenatal genetic Testing (NIPT) on maternal blood Non-invasive Molecular testing Highly accurate Highly informative Pilot screenings in progress NEXT GENERATION SEQUENCING -SEQUENZIAMENTO AD ELEVATO PARALLELISMO -DEEP SEQUENCING INNOVATIVITA -ALTA CAPACITA DIAGNOSTICA -TECNICHE DI SEQENZIAMENTO BASATE SU LIBRERIE GENOMICHE -ALTA PROCESSIVITA -TEMPI DI RISPOSTA RIDOTTI -COSTI RIDOTTI MA: ANCORA IN FASE DI VALIDAZIONE solid-phase amplification can generated up to 2,000 millions of individual reactions per flow cell flow cell -extensive dynamic changes in molecular components and biological pathways depending on ages, conditions, environment, diseases, etc -need of a longitudinal Integrated POP (ipop) using all omics analyses to interpret healthy and diseases states -Key: connecting genomic information with dynamic omics activities Proteomic and transcriptomic biomarkers: affected by POP (Personal Omics Profiling) What NGS does analyses Whole x (~ 140 Gb of sequences/sample) Whole x (~ 5 Gb/sample) A set of 100 aver. candidate genes x (~ 0.1 Gb/sample) A single medium-size gene (exons and (~ Gb/sample) DYSTROPHIN GENE HETEROZYGOUS 2619/11 DMD c.7223_7224delct GENETIC DIAGNOSIS FOR RDs Bottlenecks Bioinformatics Outflow stratification and analysis Variants interpretation (databases and registreis) Guidelines determined at the National and EU level for the health service costs sustainability NGS GENETIC DIAGNOSIS Whole genome sequencing (300 Gb) in 72 hours at 1500 Euros The diagnostic genetic tests The prevention and genetic counselling Rare Diseases The diagnostic network NGS Molecular genetics diagnostics in a few competence lab centers with high expertise Genetic counselling centers with Ethical Committees The prenatal testing Ethical issues A view on the future: next generation sequencing The clinical care NGS Technology in a few competence lab centers with high expertise Genetic counselling centers with Ethical Committees NGS Technology in a few competence lab centers with high expertise Clinical excellence Centers with trial facilities and research for clinical outocme measures ALL THESE ISSUES ARE NEEDED FOR RD MANAGING AND SHOULD BE ENSURED BY THE NATIONAL HEALTH SYSTEMS IN A SUSTAINABLE INTEGRATED AND EXCELLENCE NETWORK TELEGENETICS: concepts Telemedical technology in genetics (telegenetics) can fill the gap between the specialist and the patients Multimedia telegenetics provides interactive genetic consultations at a distance, accordingly to the European Reference Networks (ERNs) policy Best-practice-based communication of genetic testing results GOAL Facilitating communication among geneticists, obstetricians, pregnant women and all stakeholders involved in prenatal care and diagnosis TELEGENETICS: concepts Medical genetics and genetic counselling represent vital tools for communicating with patients about genetic risk, reproductive options, prenatal testing and novel therapies. There is a general consensus, promoted by the Eurogentest Network of Excellence (www.eurogentest.eu) that genetic counselling should be a mandatory accompaniment to all medical genetics interventions. Telemedical technology in genetics (telegenetics) can fill the gap between the specialist and the patients Multimedia telegenetics provides interactive genetic consultations at a distance, accordingly to the European Reference Networks (ERNs) policy Best-practice-based communication of genetic testing results GOAL Facilitating communication among geneticists, obstetricians, pregnant women and all stakeholders involved in prenatal care and diagnosis https://www.youtube.com/watch?v=boqy4w6qydi&f eature=youtu.be Networks criteria and capacities (From the Delegating and Implementing acts): Knowledge and expertise to diagnose, follow up and manage patients Evidence of good outcomes Multi-disciplinary approach Capacity to produce and implement: good practice guidelines, outcome measures and quality control Research, teaching and training Collaborate with other centres of expertise and networks How to prove this? Rare NMD ERN Identify: The expertise (Paediatrics and Adults + multidisciplinary approach) The coordination of the network (who will deal with the planning of the network) Defining the Governance of the network 10 Members in at Least 8 Countries How to make the ERN visible to the wider public. Most healthcare providers are involved in the care of all interaction groups of NMD, with patients, adding to other that healthcare a super-specialized providers area and regulatory of expertise agencies) / research Aims of the workshop: 1. exchange of knowledge and expertise in processes for the delivery of NMD care 2. assessment of existing resources both at national and international level 3. identification of gaps which need to be addressed 4. decide on a guideline document for the implementation of a ERN in the NMD field PARTICIPANTS: A.Ambrosini (IT) K.Bushby (UK) M.de Visser (NL) T.Evangelista (UK) A.Ferlini (IT) V.Karcagi (HU) J.Kirschner (DE) F.Macchia (FR) M.Moggio (IT) C.Paradas (ES) S.Parker (FR) M.Pohlschmidt (UK) J.Pouget (FR) T.Sejersen (SE) V.Straub (UK) P.Van den Bergh (BE) B.Van Engelen (NL) J.Verschuuren (NL) JL.Vives Corrons(ES) Current status of specialized neuromuscular centres in Europe Experience in the neuromuscular field on networking activities and Biobanks: European Neuromuscular Centre (ENMC) TREAT-NMD Alliance Telethon Network of Genetic Biobanks (TNGB) and/or the EuroBioBank (EBB) RD-Connect The role of the learned societies in an ERN: Current resources, such as e-learning, teaching courses and guidelines should be integrated into a future ERN. Contribute to the establishment of a European NM curriculum and to the structure of the European Board Examination. e-health: E-learning programmes are in place through the scientific societies, can be adjusted to different needs. Other resources are being assembled through projects like the cross border project SIGN (telegenetics system to perform genetic counselling and clinical genetics consultations) EU Total of 360 members 100 organizations 40 countries 260 individuals 42 countries Members in every continent apart from Africa Rare Neuromuscular Diseases ERN Areas of interest How to map different participants? Genetic Mapping Muscle diseases Inflamm atory Metabo lic Mitocho ndrial ALS/MND Coordination CMS NMJ defects Autoimmune Action Points Contact 1 or more experts in the different areas, cascade the information through those experts Peripheral Neuropathies Genetic Establish the connection between the different centres Involve patient organizations Establish the aims, structure, governance, services to be offered, integration of existing networks (most of them research based networks) Inflamm atory COUNTRIES ENGAGED UK Italy Netherlands Germany Cyprus Spain France Belgium Hungary Sweden Mapping Coordination Genetic Muscle diseases Inflamm atory Metabo lic Mitocho ndrial ALS/MND CMS NMJ defects Autoimmune Peripheral Neuropathies Genetic Inflamm atory COUNTRIES K Bushby H. Lochmuller V. Straub Marianne de Visser Ans van der Ploeg Stefano Di Donato Thomas Klopstock Ludolph, Albert C. Silani, Vincenzo OTHER : Leonard H van den Berg Pamela Shaw Jackie Palace /David Beeson Hanns Lochmuller Isabella Illa Amelia Evoli Angela Vincent Mary M. Reilly Eduardo Nobile- Orazio Sommer, Claudia Peter Van den Bergh UK Italy Netherlan ds Germany Cyprus Spain France Belgium Hungary UCL Sweden Treat-nmd Common purpose Improve quality and equity of healthcare for patients with NMDs Equity in diagnostic Uniform care standards Enable exchange of knowledge (teaching and training) Help with translational research: the development of new drugs and the recruitment into clinical trials link to research Structure Country level Governance HC prov 1 HC prov 2 HC prov 3 ISSUES: Coordinator of the ERN Where HC prov are patients representatives Nominated by the going to be represented? HC prov 9. At a country level? At an Coordinator European Centre Level? 4 HC prov 7 BOARD OF THE ERN How many HC providers are there going to be in the ERN? HC prov Depending 8 on this number; the Board of the ERN HC prov could become non governable. 5 HC prov 6 How is the Coordinator going to be nominated? Main functions of the ERN Promote and sustain good practice Organise and manage all relevant information/data Help to diffuse valid information to patients, other healthcare providers and the public Teleconsultation/Tele expertise Training and teaching Rare Neuromuscular Diseases ERN Services To Be Offered Still under discussion at the EC level, it is likely that the themes will include: healthcare in a network environment, clinical guidelines development, training provision of a better environment for clinical research including clinical trials What Services should we offer? Clinical Direct: teleconsultation,?traditional clinical appt? Support to healthcare providers: e-health (Exchange, gather and disseminate knowledge) Non Clinical Trials Clinical guidelines / patient pathways (Implement outcome and performance indicators) Epidemiological surveillance, registries Training and continuous education programmes Dissemination of information Selection of patients (registries) Training of professionals in assessment protocols Possible working Groups that could feed into the Board of the ERN Care guidelines Imaging Pathology IT Board of the ERN Genetics Social services Registries Teaching Therape utics Board of the ERN should be supported by: Among others Grant Search for sustainability Contacts with Industry External evaluation body Input about the teaching priorities Evaluation of the initiatives Input on common research priorities Screening of research projects Grant applications for research Care Training Research Trials/ Research Registries Trials/ Research TACT Care and trials CTSR Research Care Research Care and Trial Site Registry CTSR A Powerful Tool for Clinical Research and Networking in Rare Diseases Jan Kirschner Dept. of Neuropaediatrics and Muscle Disorders Universitätsklinikum Freiburg, Germany Background Established in 2007 in the scope of the TREAT-NMD project. In September 2013 the CTSR expanded to cover the field of rare neurodegenerative diseases as a branch of NeurOmics (FP7, ) and now encompasses 32 rare diseases subdivided into two groups. Number of sites since 2008 Patient numbers since 2008 Potential role for ERN Motivate all centres interested to participate in ERN to register or to update information in the CTSR Use the content of the database for the application, e.g. infrastructure of existing centres and networks, identify gaps for patient care in different European countries INCOME AND NON-MONETARY RESOURCES The ERN needs to take into consideration: Cross-country payments IT platform maintenance Technical support Administrative work Network meetings Dissemination costs Care coordination Preparatory and strategic activities From Enrique Terol presentation Strengthening the network value and capacities: and Identify Multidisciplinarity Avoid fragmentation: Grouping of diseases Identify mature and clear EU added value type of diseases Discuss y other players, partners and members Liaison with MS authorities Define the services of the Network Agree on the specific criteria for each area of expertise Self-assessment exercise (Network and members): decision of participation as members or as Associated National Centres Define Pathways models, referral criteria, clinical decision tools Information system/indicators Harmonizing genetic testing across Europe Harmonizing guidelines for genetic testing across Europe Implementing RD research at the international level
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks